Completely unbiased auxlang

A forum for all topics related to constructed languages
Fanael
greek
greek
Posts: 475
Joined: 19 Jul 2012 21:26

Completely unbiased auxlang

Post by Fanael » 08 Nov 2014 23:18

I made a completely unbiased auxlang. Here's everything you could possibly want to know about it:

What's your opinion? Is there any bias I've missed?

User avatar
Dezinaa
roman
roman
Posts: 886
Joined: 13 Oct 2013 20:33
Location: tunta, àn paànmúnu’ai

Re: Completely unbiased auxlang

Post by Dezinaa » 08 Nov 2014 23:30

Edit: Sorry if I sounded like a jerk, I thought this was a joke.
Last edited by Dezinaa on 09 Nov 2014 00:52, edited 1 time in total.

Squall
greek
greek
Posts: 578
Joined: 28 Nov 2013 14:47

Re: Completely unbiased auxlang

Post by Squall » 08 Nov 2014 23:52

Maybe that is the result of an auxlang after removing features that are difficult for most people.


But I think that an attempt is still valid.
Chinese lacks /r/ and Japanese lacks /l/. If the auxlang had /ɺ/ without /l r/, the learners would use /r/ or /l/ without conflicting phonemes.
I think a vowel inventory containing /a ə i u/ or /a e̞ i o̞ u/ is good. People that cannot say /e̞/ could use /e/ or /ɛ/ without being misinterpreted.

The consonants /p t k m n f s h~x ɺ~r~l tʃ/ seem easy for most people.
English is not my native language. Sorry for any mistakes or lack of knowledge when I discuss this language.
:bra: :mrgreen: | :uk: [:D] | :esp: [:)] | :epo: [:|] | :lat: [:S] | :jpn: [:'(]

Fanael
greek
greek
Posts: 475
Joined: 19 Jul 2012 21:26

Re: Completely unbiased auxlang

Post by Fanael » 09 Nov 2014 00:35

Dezinaa wrote:This seems a little too complicated. Auxlangs need to be as simple as possible. Otherwise they would be impossible to learn.
That's right, but you can't have everything. I don't see a way to reduce the complexity without the language losing its neutrality.
Squall wrote:If the auxlang had /ɺ/ without /l r/, the learners would use /r/ or /l/ without conflicting phonemes.
I always found this argument rather weak. I can imagine that being a problem for learners whose L1 distinguishes /r/ and /l/, who'd be looking for a distinction that isn't there.
Squall wrote:The consonants /p t k m n f s h~x ɺ~r~l tʃ/ seem easy for most people.
One of the languages I'm learning doesn't have anything remotely close to /tʃ/: /t/? /s/? They're not very [tʃ]-like.

User avatar
CMunk
greek
greek
Posts: 871
Joined: 12 Aug 2010 15:47
Location: Denmark
Contact:

Re: Completely unbiased auxlang

Post by CMunk » 09 Nov 2014 19:00

So a phonology consisting of:
/m n/
/p t k/
/s ɸ~f~h/
/l~r/
/j v~ʋ~w/

/i u/
/ə/ (this would have a lot of allophones ranging from [y] to [ɔ])
/a/

(C)V syllable structure

And I suppose an isolating grammar with no mandatory markings.
Native: :dan: | Fluent: :uk: | Less than fluent: :deu:, :jpn:, :epo: | Beginner: Image, :fao:, :non:
Creating: :con:Jwar Nong, :con:Mhmmz

User avatar
Creyeditor
mongolian
mongolian
Posts: 4478
Joined: 14 Aug 2012 19:32

Re: Completely unbiased auxlang

Post by Creyeditor » 09 Nov 2014 23:14

But /p/ vs /f/ is so difficult for many people, e.g. Indonesians [:(] And some of them also can't produce /h/ ...
Creyeditor
"Thoughts are free."
Produce, Analyze, Manipulate
1 :deu: 2 :eng: 3 :idn: 4 :fra: 4 :esp:
:con: Ook & Omlűt & Nautli languages & Sperenjas
[<3] Papuan languages, Morphophonology, Lexical Semantics [<3]

User avatar
Lao Kou
korean
korean
Posts: 5640
Joined: 25 Nov 2012 10:39
Location: 蘇州/苏州

Re: Completely unbiased auxlang

Post by Lao Kou » 10 Nov 2014 02:59

Creyeditor wrote:But /p/ vs /f/ is so difficult for many people, e.g. Indonesians [:(] And some of them also can't produce /h/ ...
And /n/ vs. /l/ is so difficult for many people across the Chinese language spectrum. That gives us:

/m n~l~r/
/p~ɸ~f~h t k/
/s/
/j v~ʋ~w/

/i u/
/ə/ (not an English bias? [>:)] )
/a/

(C)V syllable structure

Getting closer to:

without even leaving phonology. [}:D]
道可道,非常道
名可名,非常名

cntrational
roman
roman
Posts: 953
Joined: 05 Nov 2012 03:59

Re: Completely unbiased auxlang

Post by cntrational » 10 Nov 2014 03:05

Uh, all I see is a line.

User avatar
DesEsseintes
mongolian
mongolian
Posts: 4577
Joined: 31 Mar 2013 13:16

Re: Completely unbiased auxlang

Post by DesEsseintes » 10 Nov 2014 03:07

cntrational wrote:Uh, all I see is a line.
I believe that's the point. [xD]
Spoiler:
Does that sound like a weird Maths joke to anyone other than me?

cntrational
roman
roman
Posts: 953
Joined: 05 Nov 2012 03:59

Re: Completely unbiased auxlang

Post by cntrational » 10 Nov 2014 03:12

Oh ho.

User avatar
Creyeditor
mongolian
mongolian
Posts: 4478
Joined: 14 Aug 2012 19:32

Re: Completely unbiased auxlang

Post by Creyeditor » 10 Nov 2014 22:23

Did we forgot 'em poor Hawai'ians? No /t/ vs. /k/
And isn't it difficult to pronounce a Schwa for some Italian and Spanish people?

/m n~l~r/
/p~ɸ~f~h t~k/
/s/
/j v~ʋ~w/

/i u/
/a/
Creyeditor
"Thoughts are free."
Produce, Analyze, Manipulate
1 :deu: 2 :eng: 3 :idn: 4 :fra: 4 :esp:
:con: Ook & Omlűt & Nautli languages & Sperenjas
[<3] Papuan languages, Morphophonology, Lexical Semantics [<3]

Squall
greek
greek
Posts: 578
Joined: 28 Nov 2013 14:47

Re: Completely unbiased auxlang

Post by Squall » 10 Nov 2014 23:40

We do not need to have phonemes present in all languages. We need phonemes that can be learned by listening to it only once and do not require much effort to pronounce if one is not used to it.
Lao Kou wrote: /i u/
/ə/ (not an English bias? [>:)] )
/a/
No, because it includes /a/ and the English speakers will have to choose between /æ/ and /ɒ/.
And isn't it difficult to pronounce a Schwa for some Italian and Spanish people?
They can use /e/ or /o/, because there are no conflicting phonemes.
English is not my native language. Sorry for any mistakes or lack of knowledge when I discuss this language.
:bra: :mrgreen: | :uk: [:D] | :esp: [:)] | :epo: [:|] | :lat: [:S] | :jpn: [:'(]

User avatar
Creyeditor
mongolian
mongolian
Posts: 4478
Joined: 14 Aug 2012 19:32

Re: Completely unbiased auxlang

Post by Creyeditor » 10 Nov 2014 23:50

Squall wrote:We do not need to have phonemes present in all languages. We need phonemes that can be learned by listening to it only once and do not require much effort to pronounce if one is not used to it.
That's what I meant when I mentioned the /p/ vs. /f/, the /h/ and the /t/ vs. /k/ thing. These are not easy to learn by listening to it only once for speakers of Indonesian, French, etc..
Squall wrote:
And isn't it difficult to pronounce a Schwa for some Italian and Spanish people?
They can use /e/ or /o/, because there are no conflicting phonemes.
But spanish /e/ and /o/ sound like /i/ and /u/ to some people, e.g. some Arabic speakers.
Creyeditor
"Thoughts are free."
Produce, Analyze, Manipulate
1 :deu: 2 :eng: 3 :idn: 4 :fra: 4 :esp:
:con: Ook & Omlűt & Nautli languages & Sperenjas
[<3] Papuan languages, Morphophonology, Lexical Semantics [<3]

Squall
greek
greek
Posts: 578
Joined: 28 Nov 2013 14:47

Re: Completely unbiased auxlang

Post by Squall » 11 Nov 2014 00:56

If the speakers of each language had to learn at most only one foreign phoneme?
English is not my native language. Sorry for any mistakes or lack of knowledge when I discuss this language.
:bra: :mrgreen: | :uk: [:D] | :esp: [:)] | :epo: [:|] | :lat: [:S] | :jpn: [:'(]

User avatar
Lao Kou
korean
korean
Posts: 5640
Joined: 25 Nov 2012 10:39
Location: 蘇州/苏州

Re: Completely unbiased auxlang

Post by Lao Kou » 11 Nov 2014 05:43

Creyeditor wrote:/m n~l~r/
/p~ɸ~f~h t~k/
/s/
/j v~ʋ~w/

/i u/
/a/
That's the spirit! [}:D] Gettin' closer...
道可道,非常道
名可名,非常名

User avatar
QuantumWraith
cuneiform
cuneiform
Posts: 190
Joined: 20 Mar 2012 22:46

Re: Completely unbiased auxlang

Post by QuantumWraith » 11 Nov 2014 08:00

Let's not forget about Australian Aboriginal languages with no fricatives, or the various languages without distinctive nasals... or those without labial obstruents... Oh, and I believe some languages, like Arrernte, are said to only contrast /ə a/.

/l~r/
/t~k/
/j w/

/a/

...we there yet?
"Peace...? No peace!"

User avatar
Lao Kou
korean
korean
Posts: 5640
Joined: 25 Nov 2012 10:39
Location: 蘇州/苏州

Re: Completely unbiased auxlang

Post by Lao Kou » 11 Nov 2014 08:07

QuantumWraith wrote:/l~r/
/t~k/
/j w/

/a/

...we there yet?
Image [xD]
道可道,非常道
名可名,非常名

User avatar
Znex
roman
roman
Posts: 1155
Joined: 12 Aug 2013 14:05
Location: Australia

Re: Completely unbiased auxlang

Post by Znex » 11 Nov 2014 08:32

QuantumWraith wrote:Let's not forget about Australian Aboriginal languages with no fricatives, or the various languages without distinctive nasals... or those without labial obstruents... Oh, and I believe some languages, like Arrernte, are said to only contrast /ə a/.

/l~r/
/t~k/
/j w/

/a/

...we there yet?
You know, we might as well just make a language based off DNA, then it is also unbiased towards people who can speak as opposed to those who can't.

GCTAGTGATTTAGCTGATCGCCCTAGCTGATCGATGCTGTTGATGCTTAATCGAAAATGCTCGCTGTTGCTGCTGATAAATGCTAG
TCGTGATGAATGCTGATGCTGATGATGGCTGATGTCCTGATAGTCGATGTTGATGCTGATAGCTGATGCTGATCGAATGCTGATAGT
CCCTGATGCTAGATTTGCTGATCGTTAGTCGATGATGATGCTGTGGTCGAGTGCT.
:eng: : [tick] | :grc: :wls: : [:|] | :chn: :isr: : [:S] | :nor: :deu: :rom: :ind: :con: : [:x]
Conlangs: Pofp'ash, Ikwawese, Old Quelgic, Nisukil Pʰakwi, Apsiska

Mugitus
hieroglyphic
hieroglyphic
Posts: 26
Joined: 26 Apr 2014 21:53
Location: Ohio

Re: Completely unbiased auxlang

Post by Mugitus » 11 Nov 2014 12:40

I feel as if this phonology has some difficult sounds for speakers of languages like Pirahã and Rotokas, thus I propose this inventory for the auxlang:

/t~k/

/a/

Distinguishing words may be difficult... [:S]

Sample sentence:

Ta taka ka ta kata takaka!
Nimitzitta!

User avatar
Xing
MVP
MVP
Posts: 5292
Joined: 22 Aug 2010 18:46

Re: Completely unbiased auxlang

Post by Xing » 11 Nov 2014 17:35

It reminds me of my own auxlang, which I need to spend some time on.

Post Reply